Review

c57bl 6 n virgin female mice (Charles River Laboratories)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Charles River Laboratories c57bl 6 n virgin female mice
C57bl 6 N Virgin Female Mice, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse/balb+c+mice/pmc12819348-47-1-9
Average 86 stars, based on 1 article reviews

c57bl 6 n virgin female mice - by Bioz Stars, 2026-09

86/100 stars

Images

Polymerase Chain Reaction:

Article Title: IDH1-R132H enhances oncolytic HSV-1 therapy by facilitating viral entry and immune activation in glioma.
Article Snippet: Cells were cultured in suspension in ultralow attachment cell culture flasks (Corning, catalog 4616) and maintained in a humidified incubator at 37°C with 95% air and 5% CO2, passaging every 2-4 days. .. All cell lines were tested for human and mouse pathogen contamination upon acquisition using the Mouse and Human Basic Clear PCR panels from Charles River Laboratories. ..

Transgenic Assay:

Article Title: Intestinal low-abundant bacteria drive MyD88/Trif-dependent CD8 + T cell exhaustion in chronic myeloid leukemia.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primers sequence IT_16S_FWD barcoded: 5 ′ -CCATCTCATC CCTGCGTGTCTCCGACTCAGC-barcodeATTAGATACCCYGGTAGTCC-3 ′ Li et al. 59 ; Sundquist et al. 60 https://www.nature.com/articles/ ncomms9292; https://bmcmicrobiol. biomedcentral.com/articles/10.1186/14712180-7-108 IT_16S_REV_1 barcoded: 5 ′ -CCTCTCTA TGGGCAGTCGGTGATACGAGCTGACG ACARCCATG-3 ′ Li et al. 59 ; Sundquist et al. 60 https://www.nature.com/articles/ ncomms9292; https://bmcmicrobiol. biomedcentral.com/articles/10.1186/14712180-7-108 Tox_FW: CTCGCACAGAGATCAACTGG Bao et al. 61 https://www.nature.com/articles/s41467- 024-52252-2 Tox_RV: AGGTAGAGGAGAGGCTGTCTTG Bao et al. 61 https://www.nature.com/articles/s41467- 024-52252-2 Actb_FW: AGATGACCCAGATCATGTTTGAG Rubino et al. 62 https://www.sciencedirect.com/science/ article/pii/ S2666379124005974?via%3Dihub Actb_RV: GTACGACCAGAGGCATACAG; Rubino et al. 62 https://www.sciencedirect.com/science/ article/pii/ S2666379124005974?via%3Dihub Experimental models: Bacteria Bacteria: S. wadsworthensis Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 14016 S. wadsworthensis A Hitch et al. 63 CLA-AA-H173 S. wadsworthensis B Hitch et al. 63 CLA-SR-H007 Sutterella parvirubra Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 19354 Bacteria: B. wadsworthia Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 11045 Bacteria: Segatella copri Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 18205 Bacteria: L. reuteri Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM I49 Bacteria: Escherichia coli HS Jim Nataro from the University of Virginia School of Medicine, Charlottesville VA, USA. .. It is a replica of the same bacterial stock that was fully sequenced by Rasko et al. GenBank accession no. CP000802. https:// journals.asm.org/doi/10.1128/jb.0061908?url_ver=Z39.88-2003&rfr_ id=ori%3Arid%3Acrossref.org&rfr_dat=cr_ pub++0pubmed Experimental models: Organisms/strains Mouse: C57BL/6J Charles River MGI:3028467 Mouse: Myd88 KO Jax MGI:108005 Mouse: Trif KO Jax MGI:2147032 Mouse: C57BL/6J-Ptprc em6Lutzy /J Jax MGI: 6753366 SCL-tTA/BCR-ABL (BA) transgenic mouse cells Ravi Bhatia https://ashpublications.org/blood/article/ 142/6/574/495850/Metabolic-adaptationto-tyrosine-kinase-inhibition Software and algorithms FlowJo TM software v.10 TreeStar N/A GraphPad Prism® software v9.0 GraphPad N/A TrimGalore version 0.6.6 Zhang et al. 57 https://www.sciencedirect.com/science/ article/pii/ S1934590921005191?via%3Dihub (Continued on next page) Cell Reports 45, 116753, January 27, 2026 17 .. 6 to 8 weeks old female C57BL/6J (BL/6) SPF and SOPF mice were purchased from Charles River Laboratories and were maintained on the same diet and in individually ventilated cages.

Software:

other:

Article Title: Single-cell multiomic approaches define a gradual, spatially regulated epigenetic and transcriptional transition from embryonic to adult neural stem cells.
Article Snippet: Mouse: CD1 Charles River Cat# 022 Mouse: C57BL/6 Charles River Cat# 027 Mouse: Emx1Cre/Emx1 IRES cre (B6.129S2Emx1 tm1(cre)Krj /J) The Jackson Laboratory Cat# JAX:005628; RRID: IMSR_JAX:005628 Mouse: R26-LSL-Eyfp (B6.129X1Gt(ROSA)26Sor tm1(EYFP)Cos /J) The Jackson Laboratory Cat# JAX:006148; RRID: IMSR_JAX:006148

Article Title: Quantitative Analysis of Splenic Natural Killer Cells of Mice Using Imaging Flow Cytometry
Article Snippet: Mouse: BALB/c, female, 4–5 weeks of age (Charles River, strain code: 028, BALB/cAnNCrl) 2.

Recombinant:

Article Title: Species-specific cleavage of the autophagy adaptor p62 dictates responses to TNF.
Article Snippet: 17632/dkhzjnzxp5.1 The mass spectrometry raw files and the MaxQuant search results files This paper PRIDE: PXD065587 Experimental models: Cell lines Human: HEK293T cells ATCC CRL-3216 Human: HT29 cells CRUK Scotland Institute stocks (obtained from ATCC) N/A Human: hTERT-HPNE cells ATCC CRL-4023 Human: IMR-90 cells CRUK Scotland Institute stocks (obtained from ATCC) N/A Human: LNCaP cells CRUK Scotland Institute stocks (obtained from ATCC) N/A Human: MCF-7 cells CRUK Scotland Institute stocks (obtained from ATCC) N/A Human: MRC-5 cells CRUK Scotland Institute stocks (obtained from ATCC) N/A Human: Phoenix-ECO cells ATCC Cat# CRL-3214 Human: Phoenix-AMPHO cells ATCC Cat# CRL-3213 Human: hTERT RPE-1 cells CRUK Scotland Institute stocks (obtained from ATCC) N/A Human: p62 knockout LNCap cells This article N/A Human: p62 knockout LNCap cells with an empty vector This article N/A Human: p62 knockout LNCap cells overexpressing p62 WT This article N/A Human: p62 knockout LNCap cells overexpressing p62 D329* This article N/A Human: p62 knockout LNCap cells overexpressing p62 D329E This article N/A Human: p62 knockout LNCap cells overexpressing p62 D329G This article N/A Human: p62 knockout LNCap cells overexpressing p62 D329N This article N/A Human: p62 knockout HT29 cells with an empty vector This article N/A Human: p62 knockout HT29 cells overexpressing p62 WT This article N/A Human: p62 knockout HT29 cells overexpressing p62 D329* This article N/A Human: p62 knockout HT29 cells overexpressing p62 D329G This article N/A Mouse: MEF p62G331D/G331D This article N/A (Continued on next page) ll OPEN ACCESS Article e3 Molecular Cell 86, 1–13.e1–e11, April 16, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: MEF p62+/+ This article N/A Experimental models: Organisms/strains Mouse: FVB/N Charles River UK Ltd Strain Code: 207 Mouse: C57BL/6 J Charles River UK Ltd Strain Code: 027 Mouse: C57Bl/6J - SQSTM1EM1 This article N/A Mouse: FVB/N - SQSTM1EM1 This article N/A Oligonucleotides See Table S1 for all oligonucleotides This article Table S1 Recombinant DNA pLentiCRISPR Addgene Cat# 52961 pLentiCRISPR NTC2 This article N/A pLentiCRISPR caspase-2 This article N/A pLentiCRISPR caspase-8 This article N/A pLentiCRISPR caspase-9 This article N/A pLentiCRISPR p62 This article N/A pEntry vector From Terje Johanson N/A pLX304 destination vector Addgene Cat# 25890 pGEX4T1-p62/SQSTM1 From Terje Johanson N/A pEGFP-p62WT From Terje Johanson N/A p62-DPB1 domain (Daa1-122) From Terje Johanson N/A psPAX2 Addgene Cat# 12260 pVSVG Addgene Cat# 138479 pBABE-Blast J. .. Long et al.58/CRUK Scotland Institute Stocks N/A pBABE p62 WT This article N/A pBABE p62 D329* This article N/A pBABE p62 D329G This article N/A pBABE p62 D329E This article N/A pBABE p62 D329N This article N/A pBABE GST-p62-WT This article N/A pBABE GST-p62-D329* This article N/A pBABE GST-p62-D329G This article N/A pBABE mp62 This article N/A pBABE mp62 G331D This article N/A pBABE HA-p62 D329* This article N/A Software and algorithms MaxQuant 2.3.0.0 Maxquant https://www.maxquant.org/ Perseus 1.6.15.0 Maxquant https://maxquant.net/perseus/ Xcalibur software v. 4.1.31.9 Thermo Fisher Scientific https://www.thermofisher.com/uk/en/ home/industrial/mass-spectrometry/ liquid-chromatography-massspectrometry-lc-ms/lc-ms-software/lc-msdata-acquisition-software/xcalibur-dataacquisition-interpretation-software.html UniProt database human UniProtKB https://www.uniprot.org/proteomes/ UP000005640 Jalview v. 2.11.4.0.

Concentration Assay:

Article Title: Effects of exposure to ethinyl estradiol during pregnancy and lactation on the post-involution mammary gland
Article Snippet: .. The 11 concentration of EE2 was calculated to provide approximately 20 μg/kg body weight/day 12 in a 30g mouse that drinks an average of 5mL of water per day (Charles River), 13 matching exposure levels within the daily range of common EE2-based contraception 14 use. ..

Image Search Results

USP18 expression is induced by cardiac I/R injury. a Gene Ontology (GO) enrichment analysis of the RNA-seq data in I/R and control hearts at 24 h postsurgery ( n =3). b Heatmap displaying differentially expressed ubiquitination-associated genes in I/R and control hearts at 24 h postsurgery ( n =3). c Protein levels of USP18 in donor heart tissue and patients with ischemic heart disease (IHD) ( n =4). d Immunofluorescence staining of USP18 and α-actin in donor heart tissue and patients with IHD ( n =3). Scale bar=35 μm (left) and 50 μm (right). e Protein levels of USP18 in heart tissue post-IR ( n =4). f Immunofluorescence staining of USP18 and WGA in heart tissue 24 h after I/R injury ( n =5). Scale bar=50 μm. g Protein expression of USP18 in primary neonatal rat cardiomyocytes (NRVMs) after H/R challenge ( n =4). h Immunofluorescence staining of USP18 in cardiomyocytes after H/R challenge. Scale bar=50 μm. ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; WGA. Wheat germ agglutinin; DAPI. 4′,6-diamidino-2-phenylindole; H/R. Hypoxia/reoxygenation; RNA-seq. RNA sequencing; MAPK. Mitogen-activated protein kinase; GABA. γ-aminobutyric acid.

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: USP18 expression is induced by cardiac I/R injury. a Gene Ontology (GO) enrichment analysis of the RNA-seq data in I/R and control hearts at 24 h postsurgery ( n =3). b Heatmap displaying differentially expressed ubiquitination-associated genes in I/R and control hearts at 24 h postsurgery ( n =3). c Protein levels of USP18 in donor heart tissue and patients with ischemic heart disease (IHD) ( n =4). d Immunofluorescence staining of USP18 and α-actin in donor heart tissue and patients with IHD ( n =3). Scale bar=35 μm (left) and 50 μm (right). e Protein levels of USP18 in heart tissue post-IR ( n =4). f Immunofluorescence staining of USP18 and WGA in heart tissue 24 h after I/R injury ( n =5). Scale bar=50 μm. g Protein expression of USP18 in primary neonatal rat cardiomyocytes (NRVMs) after H/R challenge ( n =4). h Immunofluorescence staining of USP18 in cardiomyocytes after H/R challenge. Scale bar=50 μm. ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; WGA. Wheat germ agglutinin; DAPI. 4′,6-diamidino-2-phenylindole; H/R. Hypoxia/reoxygenation; RNA-seq. RNA sequencing; MAPK. Mitogen-activated protein kinase; GABA. γ-aminobutyric acid.

Article Snippet: To establish a cardiac-specific USP18 knockout mice model (USP18-cKO), USP18 flox/flox mice (C57BL/6 J; Shanghai Model Organisms, NM-cKO-215042) were bred with α-MHC-MerCreMer mice (C57BL/6 J; Jackson Laboratory, stock No. 024992).

Techniques: Expressing, RNA Sequencing, Control, Ubiquitin Proteomics, Immunofluorescence, Staining

$USP18 deficiency mitigates mitochondrial dysfunction, acute cardiac I/R injury, and cardiac remodeling in vivo. a 2,3,5-triphenyltetrazolium chloride (TTC) staining of heart tissue 24 h post-I/R in WT and I/R groups ( n= 5). Scale bar=0.5 cm. ⁎⁎⁎ P <0.001. b Mitochondrial DNA ( n =6) and mitochondrial complexes I and II–III activity ( n =5) 24 h post-I/R in each group. ⁎⁎ P <0.01, ⁎⁎⁎⁎ P <0.0001. c Representative electron micros c opy images of heart sections 24 h post-I/R; quantitative analysis of the mitochondrial volume density and percent of mitochondria with cristae loss in each group ( n= 5). Scale bar=10 μm (top) and 6 μm (bottom). Red arrows indicate mitochondria with cristae loss ⁎⁎⁎ P <0.001. d Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in mitochondria in the indicated groups ( n= 4). ⁎⁎ P <0.01, ⁎⁎⁎⁎ P <0.0001, ns non-significant. e H&E staining, PSR staining, and quantitative statistical analysis of cell size and left ventricle (LV) fibrotic area in WT mice and USP18-cKO mice at 4 weeks after I/R injury ( n= 5). Scale bar=1 mm (left), 50 μm (middle), and 100 μm (right). ⁎⁎ P <0.01. f Representative B-mode and M-mode echocardiographic images of LV from WT mice or USP18-cKO mice 4 weeks after I/R injury. g Cardiac function of WT mice and USP18-cKO mice after I/R injury at the indicated time points ( n= 6). ⁎ P <0.05, ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001 vs . WT, ns non-significant. USP18 . Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; WT. Wild-type; ATP. Adenosine triphosphate; H&E. Hematoxylin and eosin; PSR. Picrosirius red; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; USP18-cKO. Ubiquitin-specific protease 18 conditional knockout; LVIDd. Left ventricle internal diameter at diastole; LVISd. Left ventricle internal diameter at systole; LVEF. Left ventricle ejection fraction; LVFS. Left ventricle fractional shortening.$

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: USP18 deficiency mitigates mitochondrial dysfunction, acute cardiac I/R injury, and cardiac remodeling in vivo. a 2,3,5-triphenyltetrazolium chloride (TTC) staining of heart tissue 24 h post-I/R in WT and I/R groups ( n= 5). Scale bar=0.5 cm. ⁎⁎⁎ P <0.001. b Mitochondrial DNA ( n =6) and mitochondrial complexes I and II–III activity ( n =5) 24 h post-I/R in each group. ⁎⁎ P <0.01, ⁎⁎⁎⁎ P <0.0001. c Representative electron micros c opy images of heart sections 24 h post-I/R; quantitative analysis of the mitochondrial volume density and percent of mitochondria with cristae loss in each group ( n= 5). Scale bar=10 μm (top) and 6 μm (bottom). Red arrows indicate mitochondria with cristae loss ⁎⁎⁎ P <0.001. d Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in mitochondria in the indicated groups ( n= 4). ⁎⁎ P <0.01, ⁎⁎⁎⁎ P <0.0001, ns non-significant. e H&E staining, PSR staining, and quantitative statistical analysis of cell size and left ventricle (LV) fibrotic area in WT mice and USP18-cKO mice at 4 weeks after I/R injury ( n= 5). Scale bar=1 mm (left), 50 μm (middle), and 100 μm (right). ⁎⁎ P <0.01. f Representative B-mode and M-mode echocardiographic images of LV from WT mice or USP18-cKO mice 4 weeks after I/R injury. g Cardiac function of WT mice and USP18-cKO mice after I/R injury at the indicated time points ( n= 6). ⁎ P <0.05, ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001 vs . WT, ns non-significant. USP18 . Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; WT. Wild-type; ATP. Adenosine triphosphate; H&E. Hematoxylin and eosin; PSR. Picrosirius red; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; USP18-cKO. Ubiquitin-specific protease 18 conditional knockout; LVIDd. Left ventricle internal diameter at diastole; LVISd. Left ventricle internal diameter at systole; LVEF. Left ventricle ejection fraction; LVFS. Left ventricle fractional shortening.

Techniques: In Vivo, Staining, Activity Assay, Ubiquitin Proteomics, Knock-Out

$Overexpression of USP18 in the heart exacerbates mitochondrial dysfunction, acute cardiac injury, and cardiac remodeling following I/R in mice. a TTC staining of heart tissue 24 h post-I/R in each group ( n= 5). Scale bar=0.5 cm. ⁎⁎⁎ P <0.001. b Mitochondrial DNA levels ( n= 6) and mitochondrial complexes I and II–III activity ( n= 5) 24 h post-I/R in each group. ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. c Representative electron microscopy images of heart sections 24 h post-I/R. Quantitative analysis of mitochondrial volume density and the percent of mitochondria with cristae loss in each group ( n= 5). Scale bar=10 μm (top) and 6 μm (bottom). Red arrows indicate mitochondria with cristae loss. ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. d Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in mitochondria in the indicated groups ( n= 4). ⁎ P <0.05, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. e H&E staining, PSR staining, and quantitative statistical analysis of cell size and left ventricl e (LV) fibrotic area in AAV9-USP18-transfected mice at 4 weeks after I/R injury ( n= 5). Scale bar=1 mm (left), 50 μm (middle), and 100 μm (right). ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. f Representative B-mode and M-mode echocardiographic images of LV from AAV9-USP18-transfected mice 4 weeks after I/R injury. g Cardiac function of AAV9-USP18-transfected mice after I/R injury at the indicated time points ( n= 6). ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001 vs . AAV9-NC, ns non-significant. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; NC. Negative control; AAV9. Adeno-associated virus serotype 9; AAV9-USP18. Adeno-associated virus serotype 9 encoding USP18; TTC. 2,3,5-triphenyltetrazolium chloride; ATP. Adenosine triphosphate; H&E. Hematoxylin and eosin; PSR. picrosirius red; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; LVIDd. Left ventricle internal diameter at diastole; LVISd. Left ventricle internal diameter at systole; LVEF. Left ventricle ejection fraction; LVFS. Left ventricle fractional shortening.$

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: Overexpression of USP18 in the heart exacerbates mitochondrial dysfunction, acute cardiac injury, and cardiac remodeling following I/R in mice. a TTC staining of heart tissue 24 h post-I/R in each group ( n= 5). Scale bar=0.5 cm. ⁎⁎⁎ P <0.001. b Mitochondrial DNA levels ( n= 6) and mitochondrial complexes I and II–III activity ( n= 5) 24 h post-I/R in each group. ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. c Representative electron microscopy images of heart sections 24 h post-I/R. Quantitative analysis of mitochondrial volume density and the percent of mitochondria with cristae loss in each group ( n= 5). Scale bar=10 μm (top) and 6 μm (bottom). Red arrows indicate mitochondria with cristae loss. ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. d Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in mitochondria in the indicated groups ( n= 4). ⁎ P <0.05, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. e H&E staining, PSR staining, and quantitative statistical analysis of cell size and left ventricl e (LV) fibrotic area in AAV9-USP18-transfected mice at 4 weeks after I/R injury ( n= 5). Scale bar=1 mm (left), 50 μm (middle), and 100 μm (right). ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. f Representative B-mode and M-mode echocardiographic images of LV from AAV9-USP18-transfected mice 4 weeks after I/R injury. g Cardiac function of AAV9-USP18-transfected mice after I/R injury at the indicated time points ( n= 6). ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001 vs . AAV9-NC, ns non-significant. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; NC. Negative control; AAV9. Adeno-associated virus serotype 9; AAV9-USP18. Adeno-associated virus serotype 9 encoding USP18; TTC. 2,3,5-triphenyltetrazolium chloride; ATP. Adenosine triphosphate; H&E. Hematoxylin and eosin; PSR. picrosirius red; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; LVIDd. Left ventricle internal diameter at diastole; LVISd. Left ventricle internal diameter at systole; LVEF. Left ventricle ejection fraction; LVFS. Left ventricle fractional shortening.

Techniques: Over Expression, Staining, Activity Assay, Electron Microscopy, Transfection, Ubiquitin Proteomics, Negative Control, Virus

Effects of USP18 on H/R-induced injury to NRVMs. a-d NRVMs were transfected with USP18 siRNA and exposed to H/R. Scale bar=26 μm (top) and 50 μm (bottom). Representative confocal microscopy images showing mitochondrial morphology probed with MitoTracker Red ( n= 6) and quantification of mitochondrial length, mitochondrial fragmentation, and mitochondrial DNA levels ( n= 6) ( a and b ). Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in NRVMs in the indicated groups ( n= 4) ( c and d ). e-h NRVMs were infected with Ad-USP18 and exposed to H/R. Scale bar=26 μm (top) and 50 μm (bottom). Representative confocal microscopy images showing mitochondrial morphology probed with MitoTracker Red ( n= 6) and quantification of mitochondrial length, mitochondrial fragmentation, and mitochondrial DNA levels ( n= 6) ( e and f ). Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in NRVMs in the indicated groups ( n= 4) ( g and h ). ⁎ P <0.05, ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001, ns non-significant. US P 18. Ubiquitin-specific protease 18; H/R. Hypoxia/reoxygenation; NC. Negative control; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; NRVMs. Neonatal rat ventricular cardiomyocytes; ATP. Adenosine triphosphate; OCR. Oxygen consumption rate.

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: Effects of USP18 on H/R-induced injury to NRVMs. a-d NRVMs were transfected with USP18 siRNA and exposed to H/R. Scale bar=26 μm (top) and 50 μm (bottom). Representative confocal microscopy images showing mitochondrial morphology probed with MitoTracker Red ( n= 6) and quantification of mitochondrial length, mitochondrial fragmentation, and mitochondrial DNA levels ( n= 6) ( a and b ). Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in NRVMs in the indicated groups ( n= 4) ( c and d ). e-h NRVMs were infected with Ad-USP18 and exposed to H/R. Scale bar=26 μm (top) and 50 μm (bottom). Representative confocal microscopy images showing mitochondrial morphology probed with MitoTracker Red ( n= 6) and quantification of mitochondrial length, mitochondrial fragmentation, and mitochondrial DNA levels ( n= 6) ( e and f ). Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in NRVMs in the indicated groups ( n= 4) ( g and h ). ⁎ P <0.05, ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001, ns non-significant. US P 18. Ubiquitin-specific protease 18; H/R. Hypoxia/reoxygenation; NC. Negative control; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; NRVMs. Neonatal rat ventricular cardiomyocytes; ATP. Adenosine triphosphate; OCR. Oxygen consumption rate.

Techniques: Transfection, Confocal Microscopy, Infection, Ubiquitin Proteomics, Negative Control

USP18 aggravates cardiac I/R injury through regulation of mitochondria and inhibition of mitophagy. a Electron microscopy image showing mitophagy in USP18-cKO mouse hearts ( n= 5). Scale bar=3 μm. White arrowheads indicate sites of mitophagy. b Protein levels of PINK1, Parkin, ubiquitinated proteins (Ub), P62, and LC3II in mitochondria from heart tissue in USP18-cKO and WT mice 24 h after I/R injury ( n =4). c Electron microscopy image showing mitophagy in USP18-overexpres (OV) mouse hearts ( n =5). Scale bar=3 μm. White arrowheads indicate sites of mitophagy. d Protein levels of PINK1, Parkin, Ub, P62, and LC3II proteins in mitochondria from the heart tissue of USP18-OV mice 24 h after I/R injury ( n =4). Color shift in mitophagy dye (red) and lysosomal dye (green) in NRVMs showing mitophagy in NRVMs with USP18 siRNA transfection ( e ) or Ad-USP18 infection ( f ) and the quantitative mitophagy index in each group ( n= 5). Scale bar=9 μm. Protein levels of PINK1, Parkin, Ub, P62, and LC3II in mitochondria from NRVMs transfected with USP18 siRNA ( g ) or infected with Ad-USP18 ( h ). ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001 ⁎⁎⁎⁎ P <0.0001. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; WT. Wild-type; KO. Knockout; P62. Sequestosome 1; LC3. Microtubule-associated protein 1 light chain 3; VDAC. Voltage-dependent anion channel.

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: USP18 aggravates cardiac I/R injury through regulation of mitochondria and inhibition of mitophagy. a Electron microscopy image showing mitophagy in USP18-cKO mouse hearts ( n= 5). Scale bar=3 μm. White arrowheads indicate sites of mitophagy. b Protein levels of PINK1, Parkin, ubiquitinated proteins (Ub), P62, and LC3II in mitochondria from heart tissue in USP18-cKO and WT mice 24 h after I/R injury ( n =4). c Electron microscopy image showing mitophagy in USP18-overexpres (OV) mouse hearts ( n =5). Scale bar=3 μm. White arrowheads indicate sites of mitophagy. d Protein levels of PINK1, Parkin, Ub, P62, and LC3II proteins in mitochondria from the heart tissue of USP18-OV mice 24 h after I/R injury ( n =4). Color shift in mitophagy dye (red) and lysosomal dye (green) in NRVMs showing mitophagy in NRVMs with USP18 siRNA transfection ( e ) or Ad-USP18 infection ( f ) and the quantitative mitophagy index in each group ( n= 5). Scale bar=9 μm. Protein levels of PINK1, Parkin, Ub, P62, and LC3II in mitochondria from NRVMs transfected with USP18 siRNA ( g ) or infected with Ad-USP18 ( h ). ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001 ⁎⁎⁎⁎ P <0.0001. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; WT. Wild-type; KO. Knockout; P62. Sequestosome 1; LC3. Microtubule-associated protein 1 light chain 3; VDAC. Voltage-dependent anion channel.

Techniques: Inhibition, Electron Microscopy, Transfection, Infection, Ubiquitin Proteomics, Knock-Out

$Parkin knockdown counteracts the protection of USP18 deficiency in vivo. USP18-cKO mice were infected with AAV9-shParkin and subjected to I/R surgery. a Parkin protein levels in mouse hearts infected with AAV9-shParkin ( n= 4). b TTC staining of heart tissue 24 h post-I/R in each group ( n= 5). Scale bar=0.5 cm. c Serum levels of cTnI, CK-MB, and LDH in AAV9-shParkin-infected mice 4 h after I/R surgery ( n= 5). d DNA fragmentation and cleaved caspase-3 activity in heart tissue from AAV9-shParkin-infected mice 24 h after I/R injury ( n= 6). e Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in mitochondria in the indicated groups ( n= 4). f Mitochondrial DNA ( n= 6) and complexes I and II–III activity ( n= 5) 24 h post-I/R in each group. g Representative electron microscopy images of heart sections 24 h post-I/R. The mitochondrial volume density and percent of mitochondria with cristae loss were measured in each group ( n= 5). Scale bar=10 μm (top) and 6 μm (bottom). h Protein levels of P62, ubiquitinated proteins (Ub), and LC3II in mitochondria from heart tissue 24 h after I/R injury ( n= 4). i H&E staining and quantitative statistical analysis of cell size ( n= 5) in USP18-cKO mice and AAV9-shParkin-infected mice 4 weeks after I/R injury. Scale bar=1 μm (top) and 50 μm (bottom). j Heart weight-to-tibia length ratio (HW/TL) ( n= 6) in each group. k Representative B-mode and M-mode echocardiographic images of the left ventricle from USP18-cKO mice and AAV9-shParkin-infected mice 4 weeks after I/R injury. l Cardiac function of USP18-cKO mice and AAV9-shParkin-infected mice 4 weeks after I/R injury ( n= 6). ⁎ P <0.05, ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; cTnI. Cardiac Troponin I; CK-MB. Creatine kinase-MB isoenzyme; LDH. Lactate dehydrogenase; NC. Negative control; AAV9. Adeno-associated virus serotype 9; AAV9-USP18. Adeno-associated virus serotype 9 encoding USP18; TTC. 2,3,5-triphenyltetrazolium chloride; ATP. Adenosine triphosphate; H&E. Hematoxylin and eosin; PSR. Picrosirius red; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; LVIDd. Left ventricle internal diameter at diastole; LVISd. Left ventricle internal diameter at systole; LVEF. Left ventricle ejection fraction; LVFS. Left ventricle fractional shortening; HR. Heart rate.$

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: Parkin knockdown counteracts the protection of USP18 deficiency in vivo. USP18-cKO mice were infected with AAV9-shParkin and subjected to I/R surgery. a Parkin protein levels in mouse hearts infected with AAV9-shParkin ( n= 4). b TTC staining of heart tissue 24 h post-I/R in each group ( n= 5). Scale bar=0.5 cm. c Serum levels of cTnI, CK-MB, and LDH in AAV9-shParkin-infected mice 4 h after I/R surgery ( n= 5). d DNA fragmentation and cleaved caspase-3 activity in heart tissue from AAV9-shParkin-infected mice 24 h after I/R injury ( n= 6). e Oxygen consumption rate (OCR) and quantitative statistical analysis of basal respiration, ATP-related respiration, maximal respiration, and spare respiratory capacity in mitochondria in the indicated groups ( n= 4). f Mitochondrial DNA ( n= 6) and complexes I and II–III activity ( n= 5) 24 h post-I/R in each group. g Representative electron microscopy images of heart sections 24 h post-I/R. The mitochondrial volume density and percent of mitochondria with cristae loss were measured in each group ( n= 5). Scale bar=10 μm (top) and 6 μm (bottom). h Protein levels of P62, ubiquitinated proteins (Ub), and LC3II in mitochondria from heart tissue 24 h after I/R injury ( n= 4). i H&E staining and quantitative statistical analysis of cell size ( n= 5) in USP18-cKO mice and AAV9-shParkin-infected mice 4 weeks after I/R injury. Scale bar=1 μm (top) and 50 μm (bottom). j Heart weight-to-tibia length ratio (HW/TL) ( n= 6) in each group. k Representative B-mode and M-mode echocardiographic images of the left ventricle from USP18-cKO mice and AAV9-shParkin-infected mice 4 weeks after I/R injury. l Cardiac function of USP18-cKO mice and AAV9-shParkin-infected mice 4 weeks after I/R injury ( n= 6). ⁎ P <0.05, ⁎⁎ P <0.01, ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; cTnI. Cardiac Troponin I; CK-MB. Creatine kinase-MB isoenzyme; LDH. Lactate dehydrogenase; NC. Negative control; AAV9. Adeno-associated virus serotype 9; AAV9-USP18. Adeno-associated virus serotype 9 encoding USP18; TTC. 2,3,5-triphenyltetrazolium chloride; ATP. Adenosine triphosphate; H&E. Hematoxylin and eosin; PSR. Picrosirius red; FCCP. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone; LVIDd. Left ventricle internal diameter at diastole; LVISd. Left ventricle internal diameter at systole; LVEF. Left ventricle ejection fraction; LVFS. Left ventricle fractional shortening; HR. Heart rate.

Techniques: Knockdown, In Vivo, Infection, Staining, Activity Assay, Electron Microscopy, Ubiquitin Proteomics, Negative Control, Virus

USP18 inhibits mitophagy degradation and facilitates cardiac I/R injury through deubiquitinating and upregulating PTEN-L. a The protein levels of PTEN-L and PTEN in USP18-cKO mouse hearts 24 h after I/R injury ( n= 4). ⁎⁎⁎⁎ P <0.0001, ns non-significant. b The protein levels of PTEN-L and PTEN in AAV9-USP18-infected mouse hearts 24 h after I/R injury ( n= 4). ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001, ns non-significant. c Co-IP of USP18 and PTEN-L in NRVMs (left); NRVMs were transfected with HA-PTEN-L and Flag-USP18 (middle); Co-IP of Flag-USP18 and HA-PTEN-L in NRVMs (right). d Endogenous Co-IP of USP18 and PTEN-L in NRVMs subjected to H/R injury. e Endogenous Co-IP of USP18 and PTEN-L in hearts subjected to I/R injury. f PTEN-L ubiquitination (Ub) levels assessed by CO-IP in NRVMs subjected to H/R injury (top) and hearts subjected to I/R injury (bottom). g NRVMs were transfected with Ad-USP18 or USP18 siRNA or HA-PTEN-L and Myc-Ub and treated with MG132. Co-IP of Myc-Ub and HA-PTEN-L. h Schematic representations of t h e domains of PTEN-L involved in binding to USP18. Full-length PTEN-L or truncated PTEN-L was coexpressed with USP18 in HEK293T cells. Cells were subjected to immunoprecipitation with an anti-Myc antibody or an anti-HA antibody, followed by immunoblotting with the indicated antibodies. i Schematic representations of USP18 residues involved in binding to PTEN-L. Full-length USP18 or USP18 truncations were coexpressed with PTEN-L in HEK293T cells. Cells were subjected to immunoprecipitation with an anti-Myc antibody or an anti-HA antibody, followed by immunoblotting with the indicated antibodies. j Ub assay of PTEN-L in HEK293T cells cotransfected with Myc-USP18, Myc-USP18-mut, and Flag-PTEN-L and treated with 10 μmol/L MG132. k, l NRVMs were transfected with scRNA or USP18 siRNA ( k ), infected with Ad-NC or Ad-USP18 ( l ), and then treated with cycloheximide (CHX, 10 μmol/L) for the indicated time periods. Representative immunoblot analysis of PTEN-L protein levels in each group. ⁎⁎⁎⁎ P <0.0001 vs . scRNA or Ad-NC. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; H/R. Hypoxia-reoxygenation; PTEN. Phosphatase and tensin homolog; PTEN-L. Phosphatase and tensin homolog-long; AAV9. Adeno-associated virus serotype 9; NC. Negative control.

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: USP18 inhibits mitophagy degradation and facilitates cardiac I/R injury through deubiquitinating and upregulating PTEN-L. a The protein levels of PTEN-L and PTEN in USP18-cKO mouse hearts 24 h after I/R injury ( n= 4). ⁎⁎⁎⁎ P <0.0001, ns non-significant. b The protein levels of PTEN-L and PTEN in AAV9-USP18-infected mouse hearts 24 h after I/R injury ( n= 4). ⁎⁎⁎ P <0.001, ⁎⁎⁎⁎ P <0.0001, ns non-significant. c Co-IP of USP18 and PTEN-L in NRVMs (left); NRVMs were transfected with HA-PTEN-L and Flag-USP18 (middle); Co-IP of Flag-USP18 and HA-PTEN-L in NRVMs (right). d Endogenous Co-IP of USP18 and PTEN-L in NRVMs subjected to H/R injury. e Endogenous Co-IP of USP18 and PTEN-L in hearts subjected to I/R injury. f PTEN-L ubiquitination (Ub) levels assessed by CO-IP in NRVMs subjected to H/R injury (top) and hearts subjected to I/R injury (bottom). g NRVMs were transfected with Ad-USP18 or USP18 siRNA or HA-PTEN-L and Myc-Ub and treated with MG132. Co-IP of Myc-Ub and HA-PTEN-L. h Schematic representations of t h e domains of PTEN-L involved in binding to USP18. Full-length PTEN-L or truncated PTEN-L was coexpressed with USP18 in HEK293T cells. Cells were subjected to immunoprecipitation with an anti-Myc antibody or an anti-HA antibody, followed by immunoblotting with the indicated antibodies. i Schematic representations of USP18 residues involved in binding to PTEN-L. Full-length USP18 or USP18 truncations were coexpressed with PTEN-L in HEK293T cells. Cells were subjected to immunoprecipitation with an anti-Myc antibody or an anti-HA antibody, followed by immunoblotting with the indicated antibodies. j Ub assay of PTEN-L in HEK293T cells cotransfected with Myc-USP18, Myc-USP18-mut, and Flag-PTEN-L and treated with 10 μmol/L MG132. k, l NRVMs were transfected with scRNA or USP18 siRNA ( k ), infected with Ad-NC or Ad-USP18 ( l ), and then treated with cycloheximide (CHX, 10 μmol/L) for the indicated time periods. Representative immunoblot analysis of PTEN-L protein levels in each group. ⁎⁎⁎⁎ P <0.0001 vs . scRNA or Ad-NC. USP18. Ubiquitin-specific protease 18; I/R. Ischemia/reperfusion; H/R. Hypoxia-reoxygenation; PTEN. Phosphatase and tensin homolog; PTEN-L. Phosphatase and tensin homolog-long; AAV9. Adeno-associated virus serotype 9; NC. Negative control.

Techniques: Infection, Co-Immunoprecipitation Assay, Transfection, Ubiquitin Proteomics, Binding Assay, Immunoprecipitation, Western Blot, Virus, Negative Control

Summary of the key findings in this paper. Cardiac I/R injury upregulates USP18 in both mouse and human hearts. USP18 interacts with PTEN-L, inhibiting Parkin phosphorylation and mitochondrial translocation, thereby suppressing mitophagy and exacerbating mitochondrial dysfunction and myocardial injury. PTEN-L additionally promotes cardiac damage via a paracrine mechanism. Genetic or pharmacological targeting of the USP18-PTEN-L axis restores mitophagy and protects against I/R-induced cardiac injury, representing a potential therapeutic strategy. I/R. Ischemia/reperfusion; PTEN-L. Phosphatase and tensin homolog-long; USP18. Ubiquitin-specific protease 18; Ub. Ubiquitination.

Journal: Military Medical Research

Article Title: USP18 exacerbates myocardial I/R injury by inhibiting Parkin mitophagy through the deubiquitinase PTEN-L

doi: 10.1016/j.mmr.2026.100004

Figure Lengend Snippet: Summary of the key findings in this paper. Cardiac I/R injury upregulates USP18 in both mouse and human hearts. USP18 interacts with PTEN-L, inhibiting Parkin phosphorylation and mitochondrial translocation, thereby suppressing mitophagy and exacerbating mitochondrial dysfunction and myocardial injury. PTEN-L additionally promotes cardiac damage via a paracrine mechanism. Genetic or pharmacological targeting of the USP18-PTEN-L axis restores mitophagy and protects against I/R-induced cardiac injury, representing a potential therapeutic strategy. I/R. Ischemia/reperfusion; PTEN-L. Phosphatase and tensin homolog-long; USP18. Ubiquitin-specific protease 18; Ub. Ubiquitination.

Techniques: Phospho-proteomics, Translocation Assay, Ubiquitin Proteomics

Review

c57bl 6 n virgin female mice (Charles River Laboratories)

Structured Review

Images

Related Articles

Polymerase Chain Reaction:

Transgenic Assay:

Software:

other:

Recombinant:

Concentration Assay:

Similar Products

Image Search Results